Questões de Concurso
Para igp-sc
Foram encontradas 582 questões
Resolva questões gratuitamente!
Junte-se a mais de 4 milhões de concurseiros!
Considerando-se os documentos médicos legais e as perícias em geral, julgue os itens a seguir, assinalando a alternativa correta:
I. Via de regra, nas ações penais o laudo médico-legal não é documento sigiloso.
II. No caso de uma infração penal deixar vestígios, será absolutamente indispensável o exame de corpo de delito, não podendo supri-lo nem mesmo a confissão do acusado.
III. Ao Ministério Público, ao ofendido, ao querelante, ao acusado e ao assistente de acusação serão facultadas a elaboração de quesitos e a indicação de assistente técnico.
Considere as afirmativas abaixo referentes aos três principais objetivos em se tratando de segurança da informação:
I. A confidencialidade garante que a informação não será conhecida por pessoas que não estejam autorizadas para tal.
II. A integridade garante que a informação armazenada ou transferida mantém suas características originais e é apresentada corretamente às entidades que tenham acesso a mesma.
III. A disponibilidade visa garantir a existência de qualquer entidade que tenha acesso à informação.
Estão corretas as afirmativas:
TSUNAMI VICTIM
By Charles Choi | October 25, 2017 1:00 pm
Paragraph 1 Tsunamis have claimed hundreds of thousands of lives in the
past two decades.Now a new study finds that a 6,000-year-old
skull may come from the earliest known victim of these killer
waves.
Paragraph 2 The partial human skull was discovered in 1929 buried in a
mangrove swamp outside the small town of Aitape Papua New
Guinea, about 500 miles north of Australia. Scientists originally
thought it belonged to an ancient extinct human species, Homo
erectus. However, subsequent research dated it to about 5,000
or 6,000 years in age, suggesting that it instead belonged to a
modern human.
A Rare Specimen
Paragraph 3 The skull is one of just two examples of ancient human remains
found in Papua New Guinea after more than a century of work
there. As such, archaeologists wanted to learn more about this
skull to elucidate how people settled this region.
Paragraph 4 The scientists went back to where this skull was found and
sampled the soil in which itwas discovered. They focused on
details such as sediment grain size and composition.
Paragraph 5 In the sediment, the researchers discovered a range of
microscopic organisms from the ocean known as diatoms. These
were similar to ones found in the soil after a 1998 tsunami killed
more than 2,000 people in Papua New Guinea — for instance,
their shells of silicawere broken, likely by extremely powerful
forces.
Paragraph 6 These diatom shells, combined with the chemical compositions
and the size ranges of the grains, all suggest that a tsunami
occurred when the skull was buried. The researchers suggested
the catastrophe either directly killed the person or ripped open
their grave.
Paragraph 7 Tsunamis, which are giant waves caused by earthquakes,
volcanic eruptions or underwater landslides, are some of the
deadliest natural disasters known. The 2004 tsunami in the
Indian Ocean killed more than 230,000 people, a higher death
toll than any fire or hurricane.
Paragraph 8 The site where the skull was found is currently about 7.5 miles
away from thecoast. Still, the researchers noted that back when
whoever the skull belonged to wasalive, sea levels were higher,
and the area would have been just behind the shoreline.
Paragraph 9 The waves of the tsunami that hit Papua New Guinea in 1998
reached more than 50 feet high and penetrated up to three miles
inland. “If the event we have identified resulted from a similar
process, it could have also resulted in extremely high waves,”
study co-lead author Mark Golitko, an archaeologist at the
University of Notre Dame in Indiana and the Field Museum in
Chicago.
Paragraph 10 These results show “that coastal populations have been
vulnerable to such events for thousands of years,” Golitko said.
“People have managed to live with such unpredictable and
destructive occurrences, but it highlights how vulnerable people
living near the sea can be. Given the far larger populations that
live along coastlines today, the potential impacts are far more
severenow.”
Paragraph 11 Golitko plans to return to the area over thenext few years “to
further study the frequency of such events, how the
environment changed over time, and how people have coped
with the environmental challenges of living in that environment.”
He and his colleagues detailed their findings Wednesday in the
journal PLOS O.
Retrieved and adapted from:
<http://blogs.discovermagazine.com/dbrief/2017/10/25/first-tsunami-
victim/#.WfYiYmhSzIU>
TSUNAMI VICTIM
By Charles Choi | October 25, 2017 1:00 pm
Paragraph 1 Tsunamis have claimed hundreds of thousands of lives in the
past two decades.Now a new study finds that a 6,000-year-old
skull may come from the earliest known victim of these killer
waves.
Paragraph 2 The partial human skull was discovered in 1929 buried in a
mangrove swamp outside the small town of Aitape Papua New
Guinea, about 500 miles north of Australia. Scientists originally
thought it belonged to an ancient extinct human species, Homo
erectus. However, subsequent research dated it to about 5,000
or 6,000 years in age, suggesting that it instead belonged to a
modern human.
A Rare Specimen
Paragraph 3 The skull is one of just two examples of ancient human remains
found in Papua New Guinea after more than a century of work
there. As such, archaeologists wanted to learn more about this
skull to elucidate how people settled this region.
Paragraph 4 The scientists went back to where this skull was found and
sampled the soil in which itwas discovered. They focused on
details such as sediment grain size and composition.
Paragraph 5 In the sediment, the researchers discovered a range of
microscopic organisms from the ocean known as diatoms. These
were similar to ones found in the soil after a 1998 tsunami killed
more than 2,000 people in Papua New Guinea — for instance,
their shells of silicawere broken, likely by extremely powerful
forces.
Paragraph 6 These diatom shells, combined with the chemical compositions
and the size ranges of the grains, all suggest that a tsunami
occurred when the skull was buried. The researchers suggested
the catastrophe either directly killed the person or ripped open
their grave.
Paragraph 7 Tsunamis, which are giant waves caused by earthquakes,
volcanic eruptions or underwater landslides, are some of the
deadliest natural disasters known. The 2004 tsunami in the
Indian Ocean killed more than 230,000 people, a higher death
toll than any fire or hurricane.
Paragraph 8 The site where the skull was found is currently about 7.5 miles
away from thecoast. Still, the researchers noted that back when
whoever the skull belonged to wasalive, sea levels were higher,
and the area would have been just behind the shoreline.
Paragraph 9 The waves of the tsunami that hit Papua New Guinea in 1998
reached more than 50 feet high and penetrated up to three miles
inland. “If the event we have identified resulted from a similar
process, it could have also resulted in extremely high waves,”
study co-lead author Mark Golitko, an archaeologist at the
University of Notre Dame in Indiana and the Field Museum in
Chicago.
Paragraph 10 These results show “that coastal populations have been
vulnerable to such events for thousands of years,” Golitko said.
“People have managed to live with such unpredictable and
destructive occurrences, but it highlights how vulnerable people
living near the sea can be. Given the far larger populations that
live along coastlines today, the potential impacts are far more
severenow.”
Paragraph 11 Golitko plans to return to the area over thenext few years “to
further study the frequency of such events, how the
environment changed over time, and how people have coped
with the environmental challenges of living in that environment.”
He and his colleagues detailed their findings Wednesday in the
journal PLOS O.
Retrieved and adapted from:
<http://blogs.discovermagazine.com/dbrief/2017/10/25/first-tsunami-
victim/#.WfYiYmhSzIU>
TSUNAMI VICTIM
By Charles Choi | October 25, 2017 1:00 pm
Paragraph 1 Tsunamis have claimed hundreds of thousands of lives in the
past two decades.Now a new study finds that a 6,000-year-old
skull may come from the earliest known victim of these killer
waves.
Paragraph 2 The partial human skull was discovered in 1929 buried in a
mangrove swamp outside the small town of Aitape Papua New
Guinea, about 500 miles north of Australia. Scientists originally
thought it belonged to an ancient extinct human species, Homo
erectus. However, subsequent research dated it to about 5,000
or 6,000 years in age, suggesting that it instead belonged to a
modern human.
A Rare Specimen
Paragraph 3 The skull is one of just two examples of ancient human remains
found in Papua New Guinea after more than a century of work
there. As such, archaeologists wanted to learn more about this
skull to elucidate how people settled this region.
Paragraph 4 The scientists went back to where this skull was found and
sampled the soil in which itwas discovered. They focused on
details such as sediment grain size and composition.
Paragraph 5 In the sediment, the researchers discovered a range of
microscopic organisms from the ocean known as diatoms. These
were similar to ones found in the soil after a 1998 tsunami killed
more than 2,000 people in Papua New Guinea — for instance,
their shells of silicawere broken, likely by extremely powerful
forces.
Paragraph 6 These diatom shells, combined with the chemical compositions
and the size ranges of the grains, all suggest that a tsunami
occurred when the skull was buried. The researchers suggested
the catastrophe either directly killed the person or ripped open
their grave.
Paragraph 7 Tsunamis, which are giant waves caused by earthquakes,
volcanic eruptions or underwater landslides, are some of the
deadliest natural disasters known. The 2004 tsunami in the
Indian Ocean killed more than 230,000 people, a higher death
toll than any fire or hurricane.
Paragraph 8 The site where the skull was found is currently about 7.5 miles
away from thecoast. Still, the researchers noted that back when
whoever the skull belonged to wasalive, sea levels were higher,
and the area would have been just behind the shoreline.
Paragraph 9 The waves of the tsunami that hit Papua New Guinea in 1998
reached more than 50 feet high and penetrated up to three miles
inland. “If the event we have identified resulted from a similar
process, it could have also resulted in extremely high waves,”
study co-lead author Mark Golitko, an archaeologist at the
University of Notre Dame in Indiana and the Field Museum in
Chicago.
Paragraph 10 These results show “that coastal populations have been
vulnerable to such events for thousands of years,” Golitko said.
“People have managed to live with such unpredictable and
destructive occurrences, but it highlights how vulnerable people
living near the sea can be. Given the far larger populations that
live along coastlines today, the potential impacts are far more
severenow.”
Paragraph 11 Golitko plans to return to the area over thenext few years “to
further study the frequency of such events, how the
environment changed over time, and how people have coped
with the environmental challenges of living in that environment.”
He and his colleagues detailed their findings Wednesday in the
journal PLOS O.
Retrieved and adapted from:
<http://blogs.discovermagazine.com/dbrief/2017/10/25/first-tsunami-
victim/#.WfYiYmhSzIU>
Sobre a estrutura e organização dos cromossomos humanos, analise as informações a seguir:
I. Os telômeros protegem as extremidades dos cromossomos.
II. Os telômeros são sintetizados por uma transcriptase reversa.
III. Os centrômeros são importantes para a segregação dos genes.
IV. O DNA genômico está organizado em nucleossomos, que é a unidade fundamental da cromatina.
V. O cariótipo humano é composto por cromossomos metacêntricos, submetacêntricos e telocêntricos.
Assinale a alternativa que representa a sequência correta:
Testes simples, como tipagem ABO Rh, podem revelar polimorfismos sanguíneos e auxiliar no esclarecimento de situações legais. Considere os loci para os grupos sanguíneos ABO e Rh, sendo que no primeiro, A e B são codominantes entre si e dominantes em relação ao alelo O e no segundo locus, Rh+ é dominante sobre Rh-. O pai de certa família pertence aos grupos sanguíneos AB e Rh- e é casado com uma mulher dos grupos O e Rh+. Eles têm quatro filhos, com os seguintes fenótipos:
Filho 1: AB, Rh+
Filho 2: A, Rh-
Filho 3: B, Rh+
Filho 4: O, Rh+
Qual dessas crianças é adotada e qual é filha apenas do pai, de seu primeiro casamento.
Em relação à estrutura e organização dos cromossomas analise se as afirmações são falsas (F) ou verdadeiras (V):
( ) Um cromossomo contém várias moléculas de DNA associadas a moléculas de RNA e proteínas.
( ) Um cromossomo humano pode conter mais de mil genes.
( ) Os genes do RNA ribossomal humano estão localizados nos braços curtos dos cromossomos 13, 14, 15, 21 e 22, que são mantidos próximos dentro do nucléolo, que é uma região onde o RNA ribossomal é sintetizado e onde os ribossomos começam a ser montados.
( ) Os cromossomos metafásicos são formados pela cromatina no seu estado condensado.
( ) Um dos dois cromossomos X é, em grande parte, inativado nas células das mulheres com cariótipo normal, mas não nos homens, que possuem apenas um X.
Assinale a alternativa que representa a sequência correta:
O esclarecimento de situações cotidianas da vida ou cenas de crimes pode ser feito em base ao polimorfismo gênico e às diferenças nos mecanismos de herança. Analise as afirmações a seguir, selecionando as:
I. Para rastrear relações de parentesco com pessoas falecidas, marcadores de DNA mitocondrial, avaliados por SNPs, podem ser especialmente uteis porque o indivíduo estudado herda o genótipo completo do pai.
II. Marcadores de cromossomo Y e DNA mitocondrial podem ser utilizados em investigações criminais, particularmente quando o criminoso pode ser um parente de alguém cujo perfil pode ser facilmente acessado pela perícia.
III. Uma das aplicações mais poderosas do perfil de DNA é aquela de provar que o suspeito não é o criminoso.
Assinale a alternativa que representa a sequência
correta:
A técnica de tipagem de DNA baseada em análise de restrição enzimática de fragmentos longos (do inglês RFLP – Restriction Fragment Long Repeats) utiliza enzimas capazes de cortar pares de base (pb) do DNA de dupla fita em pontos específicos. Baseado nesta informação observe as sequências a seguir de três segmentos do mesmo gene correspondentes a três pessoas diferentes que foram submetidas a análise de restrição com duas enzimas diferentes. A enzima HpaII tem sítio de restrição em C↓CGG e a enzima EcoRI em G↓AATTC. Assinale a resposta CORRETA das possíveis bandas encontradas no gel de restrição.
Caso 1
AAATCGCGTTAAGGGATATCCGGCCTCGAATTCCG
TAATCCGGCTTAAGGCTTGTGCATG
TTTAGCGCAATTCCCTATAGGCCGGAGCTTAAGGC
ATTAGGCCGAATTCCGAACACGTAC
Caso 2
AAATCGCGTTAAGGGATATCGGGCCTCGAATTCCG
TAATCCGGCTTAAGGCTTGTGCATG
TTTAGCGCAATTCCCTATAGCCCGGAGCTTAAGGCA
TTAGGCCGAATTCCGAACACGTAC
Caso 3
AAATCGCGTTAAGGGATATCGGGCCTCGTATTCCG
TAATCTGGCTTAAGGCTTGTGCATG
TTTAGCGCAATTCCCTATAGGCCGGAGCATAAGGC
ATTAGACCGAATTCCGAACACGTAC
As reações de amplificação de DNA, como a reação em cadeia da polimerase (PCR) se tornaram muito úteis em laboratórios clínicos e forenses. Essas reações possibilitam a identificação ou quantificação (qPCR) do DNA presente em amostras clínicas para detectar, por exemplo, alterações genéticas, infecções por microrganismos ou presença de DNA humano diferente ao da vítima no esclarecimento de crimes ou de violações. Embora robusta, uma preocupação constante na realização das PCR é a possibilidade de ocorrerem resultados falso-negativos pela presença de inibidores da reação no DNA utilizado. Sobre inibidores em reações de amplificação da polimerase (PCR) identifique as alternativas corretas:
I. Inibidores comuns nas reações de PCR de interesse forense são hematina, melanina, colágeno, ácido tânico e ácido húmico.
II. Os inibidores podem se ligar diretamente ao DNA ou interferir na ação da DNA polimerase.
III. A presença de ureia, em amostras de urina, evita a ocorrência de inibição da PCR. Eventualmente, faz-se adição de ureia às amostras clínicas para melhorar o desempenho da reação.
IV. Entre os medicamentos imunossupressores somente o aciclovir não causa inibição na PCR.
V. Reagentes comuns utilizados na extração do DNA ou na PCR podem se comportar como inibidores, entre eles se destacam SDS, fenol, álcool etílico e isopropílico e excesso de KCl.
Assinale a alternativa que representa a sequência correta:
O genoma humano é constituído por grande quantidade de DNA que contém na sua estrutura as informações necessárias para especificar as características essenciais que fazem dos seres humanos organismos funcionais. Sobre a organização do genoma humano analise qual(ais) afirmação(ões) a seguir está(ão) corretas:
I. Os genes são organizados em ordem linear no cromossoma, e cada um possui uma posição precisa denominada loci.
II. No conceito de autossomas estão incluídos os 23 pares de cromossomas, havendo diferença nos homens (XY) e nas mulheres (XX) em apenas um par.
III. Além do genoma nuclear, o genoma da mitocôndria integra o genoma humano. E cada célula pode conter centenas ou milhares de mitocôndrias.
IV. Considerando o número de indivíduos da espécie humana, se espera que ocorram diversas variações genômicas, por esse motivo no projeto genoma humano os genomas sequenciados são considerados como “referência” da espécie.
V. Dos bilhões de pares de base que compõem o DNA humano em cada genoma, apenas 1,5% ou menos codificam proteínas.
Assinale a alternativa que representa a sequência correta:
Conheça nossos planos